Women s Unpaid Labor By Susan M. Shaw And Janet Lee s Women

In the quite hours of early morning my mother rises out of bed, as she has done every morning for the past twenty-two years. She quietly begins her long day by making tea and cooking breakfast. Before the day ends, my mother would have cooked several meals, cleaned several times and worked a full time job. My mother’s daily routine is not unique and has historically been done by women for centuries. Even today, women are supposed to do it all, have a family, and take care of the house/children and work full-time. Women who are in the workforce are unpaid and the work they do at home is viewed as inferior. They often deal with sexism and racism in the workplace. Changes in law and our thought process need to occur to create and an equitable system of work for all women. Women’s unpaid labor in maintains a systems of oppression in many ways. In Susan M. Shaw and Janet Lee’s Women’s Voices Feminist Visions unpaid labor done by many women is, â€Å"undervalued as women’s formal productive paid labor in the workforce is prioritized† (Shaw Lee, 2015, 471). Shaw and Lee are saying that women work at home is devalued because it is viewed as informal and as work that is done out of love or is natural work. Since the work being done is viewed as natural work, it further reinforces gender stereotypes by stating that women are supposed to do the household work which is deemed more as feminine. This thought process follows patriarchal thinking, where women are expected to do theShow MoreRelatedStephen P. Robbins Timothy A. Judge (2011) Organizational Behaviour 15th Edition New Jersey: Prentice Hall393164 Words   |  1573 PagesMarketing: Patrice Lumumba Jones Senior Marketing Manager: Nikki Ayana Jones Senior Managing Edit or: Judy Leale Production Project Manager: Becca Groves Senior Operations Supervisor: Arnold Vila Operations Specialist: Cathleen Petersen Senior Art Director: Janet Slowik Art Director: Kenny Beck Text and Cover Designer: Wanda Espana OB Poll Graphics: Electra Graphics Cover Art: honey comb and a bee working / Shutterstock / LilKar Sr. Media Project Manager, Editorial: Denise Vaughn Media Project Manager, Production:Read MoreLibrary Management204752 Words   |  820 PagesCongress Subject Headings: Principles and Application, Fourth Edition Lois Mai Chan Developing Library and Information Center Collections, Fifth Edition G. Edward Evans and Margaret Zarnosky Saponaro Metadata and Its Impact on Libraries Sheila S. Intner, Susan S. Lazinger, and Jean Weihs Organizing Audiovisual and Electronic Resources for Access: A Cataloging Guide, Second Edition Ingrid Hsieh-Yee Introduction to Cataloging and Classification, Tenth Edition Arlene G. Taylor LIbRaRy and InfoRMaTIonRead MoreManaging Information Technology (7th Edition)239873 Words   |  960 Pagesand permission should be obtained from the publisher prior to any prohibited reproduction, storage in a retrieval system, or transmission in any form or by any means, electronic, mechanical, photocopying, recording, or likewise. To obtain permission(s) to use material from this work, please submit a written request to Pearson Education, Inc., Permissions Department, One Lake Street, Upper Saddle River, New Jersey 07458. Many of the designations by manufacturers and sellers to distinguish their

How to Cope with Culture Shock - 1298 Words

How to Cope with Culture Shock | | | | | | * Front Page * What is h2g2? * Who s Online * Write an Entry * Browse * Announcements * Feedback * h2g2 Help * RSS Feeds | | | | | | | | Contact Us Like this page? Send it to a friend! | | | | | | | | | | | | | | | | | | In today s global economy, where major firms have branches in most areas of the world, many more people than ever before contemplate living in another country. For some this means a job in a country with the same first language, but for most the first language of the country will be different. This is especially true of non-native English speakers. The culture of the host country may also be†¦show more content†¦Once there the fourth, and most unexpected, stage occurs and this is referred to as the reverse culture shock stage. Upon arriving back, the returning resident will be eager to share their experiences of another culture that have made them a different person. However, they have returned to a group of people, and indeed a country, that has changed in the interim. These changes can be subtle or far-reaching, but they will affect the way that the returnee is accepted by, or accepts, their own host country and its residents. Often the change required will be too great. T he returnee will in many cases deal with this by returning to the host culture or exploring another culture and language.How can Culture Shock be Lessened?The most important factor in coping with culture shock is to accept that, however well you prepare, it will affect you to some extent. As Schumann found in the course of his research, the four stages outlined above can never be avoided, but the length of time spent in each of the stages can be greatly reduced by taking certain courses of action.Firstly, the would-be immigrant should study the culture and language of their intended destination. This may sound obvious, but in the maelstrom of moving and sorting out affairs it is often forgotten. Even having a few words of the target language can help smooth your path in the early days. Also the realisation that thereShow MoreRelatedCulture Shock Of The United States Essay1537 Words   |  7 PagesCulture Shock has played a tremendous role in the growth of cultural ecology because i t is an issue that is constantly growing all over the world. In the United States, it may not seem like things are changing involving culture shock, but it is not any different then the changes in places like Africa and China for example. It is developing equally across the world because there are now more ways to travel. So, what exactly is culture shock anyways? Well, it is known as going to a foreign or unfamiliarRead More Culture Schock Essay1171 Words   |  5 Pages Culture in ancient times was defined as â€Å"the sum total of the equipment of the human individual, which enables him to be attuned to his immediate environment on the historical past on the other†. It reflects in effect what humans have added to Nature. It comprises the spiritual, material, intellectual and emotional features of a society and includes, in addition to the arts and letters, the value systems, traditions, modes of life and beliefs of the society. It also absorbs from other culturesRead MoreMulticulturalism in Organizations Essay916 Words   |  4 Pagesmulticulturalism, how the process happens and how it is expressed in organisations. Culture can be showed through values, rituals, heroes and symbols; thought grouping and categorising people and the word around us we make up our mind of what is good or bad and right or wrong. Although, human come from different backgrounds and â€Å"if you only try to understand humans in individual basis you will not understand the person or its reasons †¦ you cannot judge the behaviour of a different culture with your ownRead MoreMulticulturalism : People From All Around The World1326 Words   |  6 PagesMulticulturalism: people from all around the world live in Canada.With all kinds of backgrounds, cultures and religious beliefs. Canada is seen as the country of mosaiques because we fit everyone in, everyone is welcome. Freedom: in Canada everyone has human rights, such as, the right to speak up, wear whatever clothing you like, practicing another faith, we do not have a dictatorship, and are against violence, etc. Free health care: everyone has access to it Equality: Men and women are seen as equalsRead MoreCultural Adjustment And Its Effects On Society938 Words   |  4 Pages which is called cultural shock. However, learning the phases of cultural adjustment will aid to deal with the culture shock that many people have faced it in different ways, including Chinese, myself, and other international students. Yaping Tang states in a 1996 essay, â€Å"Polite but Thirsty†, that there are many Chinese students who have come to the United States in order to do research or get an education, and they have faced an experience of dealing with culture shock. Chinese students, for exampleRead MoreEmbracing The Shock Essay1692 Words   |  7 Pages Final Paper: Embracing the Shock   Ã‚  Ã‚   The effects of earthquake aftershocks are unpredictable and can last for many years; the effects of culture shock happen to be the remarkably similar. Culture shock takes place when someone enters into an unfamiliar culture due to a vacation, humanitarian project, study abroad opportunity, etc. Barna (1976) explains culture shock as being a type of disease that many do not understand they have, yet it handicaps people and prevents them from knowing that theyRead MoreCultural Shock Essay1234 Words   |  5 PagesCultural shock is the reaction to cultural differences after moving to a foreign country. It can be triggered by differences in food, social customs, and language. The four phases of cultural shock are the honeymoon, rejection, regression, and adjustment phases (Levine). The honeymoon phase is characterized by an excitement for new surroundings. During the rejection phase, frustration replaces the excitement; inconvenient cultural differences become more noticeab le, and adjustment is difficult. TheRead MoreHigh Level Of Stress And Its Effects On The New Environment1394 Words   |  6 Pageshigh level of stress due to the adaptation process that they have to undergo. 2 This process is very complex for these students as in a very short time they have to change their attitudes, values, behaviors in the spirit of complying with the new culture and environment. International students experience more stress than the students from the host country as the usual fit between the person and environment has broken down. 3 Similarly, I came into United States in August-2014 as an InternationalRead MoreAustralia Is A Popular Study Country With Students897 Words   |  4 Pagesnot easy because of language proficiency, crossing culture and different social norms. For successfully studying at university, they need to understand to Australian culture and they need to adjust to university culture as soon as possible. This essay takes a look in the particular problems of international students at university study, such as language barriers, social supports, culture shocks and time management. Also I will present how to cope with the problems for successful adjustment to universityRead MoreThe United States Based Engineering Manager Who Now Works For Siemens Essay872 Words   |  4 Pagesand Siemens, Todd has had extensive experience in dealing with cross-cultural issues, from traveling abroad to working hand in hand with people of different cultures. Siemens Corporate Culture In order to fully appreciate how a company approaches cross-cultural issues, it is important to note a few things about their corporate culture, and how that fits in with the host nations of their overseas offices. Siemens corporate strategy involves a flatter power structure in order to have fewer layers between

Human Genome And A Look Into Schizophrenia Biology Essay Example For Students

Human Genome And A Look Into Schizophrenia Biology Essay Unphased determine whether a familial discrepancy is associated with a disease or trait. If association is present, a peculiar allelomorph, genotype or haplotype of a polymorphism or polymorphism ( s ) will be seen more frequently than expected by opportunity in an single transporting the trait. instance ( Schizophrenia ) and control ( normal ) . frequence of allelomorphs or genotypes is compared between the instances and controls. One job with the case-control design is that genotype and haplotype frequences vary between cultural or geographic populations. We will write a custom essay on Human Genome And A Look Into Schizophrenia Biology specifically for you for only $16.38 $13.9/page Order now After the gel cataphoresis, the PCR merchandises were added with 40I?l of 100 % ethyl alcohol and set into -20a„? icebox, for at least 2 hours, this is to precipitate out the amplified fragment of DNA. Then, the mixture was centrifuged at 3000rpm for 30 proceedingss. After remotion of the liquid waste, 24I?l of 70 % ethyl alcohol was added to rinse the sample, and centrifuged at 3500rpm for 20 minutees. The rinsing procedure was repeated one time more. After that, the samples were dried under 10Pa of force per unit area for 20 proceedingss. 10I?l of Milli Q H2O was added to each of the dried sample and heated at 60a„? for 1 minute for blending the H2O and PCR merchandise. Deoxyribonucleic acid Sequencing The stuff used in the Deoxyribonucleic acid sequencing reactions include: primer, either frontward or change by reversal ; 5X Seuqencing buffer ( Applied Biosystems ) ; PCR merchandise ; and Milli Q H2O that to do the entire volume into 15I?l. The Deoxyribonucleic acid sequencing initiated at 95a„? for 5 proceedingss. Each rhythm contains 30 seconds at 95a„? for denaturation, 30s at tempering temperature for each brace of primer for tempering of primer to template DNA, 1 minute at 72a„? for elongation of the merchandise. In the experiment, 30 rhythms were completed for each brace of the primers. Following the reaction rhythms, there was 5 proceedingss at 72a„? as concluding elongation clip. And the reaction merchandises were temporarily stored in the machine at 4a„? as the concluding clasp temperature. 0.72I?l of primer, 3I?l of sequencing buffer, 0.75I?l of Big Dye Terminator version 3.1 ( Applied Biosystems ) , 1.5I?l of PCR merchandise sample and 9.03I?l of Milli Q H2O were made up into reaction mixture. Primer Sequence B22f1S TTAAGCACAGCTACTAGATC B22r2 CAGGGAGGTAGGAATGAGAATCTG B22r2S TTCCCTGGGATTATACATAT B22f3 TCTTTGAGTTATCAGGATTGGG B22f4S ACCATTCTTAATGAATTCCA Table 2: Primers used in sequencing. hypertext transfer protocol: //wpcontent.answers.com/wikipedia/commons/thumb/d/df/DNA_Sequencin_3_labeling_methods.jpg/220px-DNA_Sequencin_3_labeling_methods.jpg Figure 2: Conventional drawing of DNA sequencing. Sequencing Product Purification The sequencing merchandises were added with 48I?l of 100 % ethyl alcohol and set into -20a„? icebox, for at least 30 proceedingss, this is to precipitate out the Deoxyribonucleic acid fragment. Then, the mixture was centrifuged at 3000rpm for 30 proceedingss. After remotion of the liquid waste, 24I?l of 70 % ethyl alcohol was added to rinse the sample, and centrifuged at 3500rpm for 20 proceedingss. The rinsing procedure was repeated twice more. After that, the samples were dried under 10Pa of force per unit area for 20 proceedingss. 10I?l of Hi-Deionized formamide was added to each of the dried sample and heated at 95a„? for 3 minute to denature. Consequences Consequences generated by Genepop , By utilizing Hardy-Weinberg equilibrium, we try to prove if the population ( Beijing ) used in the experiment is in equilibrium. Control sample from normal individuals was used to run the Genepop plan. Venue P-value Standard Error W A ; C R A ; H Stairss rs252973 1.0000 0.0000 -0.0395 -0.0398 14657 switches rs10050588 1.0000 0.0000 -0.0055 -0.0056 68379 switches rs171677 1.0000 0.0000 -0.0282 -0.0284 7920 switches rs252975 1.0000 0.0000 -0.0337 -0.0339 10920 switches rs173767 1.0000 0.0000 -0.0440 -0.0442 17820 switches rs153298 0.6843 0.0035 -0.0583 -0.0586 83991 switches rs153299 1.0000 0.0000 -0.0440 -0.0442 18138 switches rs252976 .u0973effd93375e50281bda78684f0b49 , .u0973effd93375e50281bda78684f0b49 .postImageUrl , .u0973effd93375e50281bda78684f0b49 .centered-text-area { min-height: 80px; position: relative; } .u0973effd93375e50281bda78684f0b49 , .u0973effd93375e50281bda78684f0b49:hover , .u0973effd93375e50281bda78684f0b49:visited , .u0973effd93375e50281bda78684f0b49:active { border:0!important; } .u0973effd93375e50281bda78684f0b49 .clearfix:after { content: ""; display: table; clear: both; } .u0973effd93375e50281bda78684f0b49 { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u0973effd93375e50281bda78684f0b49:active , .u0973effd93375e50281bda78684f0b49:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u0973effd93375e50281bda78684f0b49 .centered-text-area { width: 100%; position: relative ; } .u0973effd93375e50281bda78684f0b49 .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u0973effd93375e50281bda78684f0b49 .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u0973effd93375e50281bda78684f0b49 .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u0973effd93375e50281bda78684f0b49:hover .ctaButton { background-color: #34495E!important; } .u0973effd93375e50281bda78684f0b49 .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u0973effd93375e50281bda78684f0b49 .u0973effd93375e50281bda78684f0b49-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u0973effd93375e50281bda78684f0b49:after { content: ""; display: block; clear: both; } READ: Gamelan - Music of Indonesia Essay1.0000 0.0000 -0.0444 -0.0447 18232 switches rs1849173 0.8343 0.0016 -0.0430 -0.0432 83419 switches Table 3: Consequences generated from Genepop. Two estimations of Fis: Weir A ; Cockerham s ( 1984 ) estimation ( W A ; C ) , and Robertson A ; Hill s ( 1984 ) estimation ( R A ; H ) . All ( Fisher s method ) : Chi2: 1.1210 ; Df: 18.0000 ; Prob: 1. Under the rule of chance, if the P value is less than 5 per centum, the two Numberss are said to be significantly different, the void hypothesis, in this instance the random brotherhood of gametes, is rejected. From the above tabular array we can see that all SNPs tested have p-value larger than 0.05 ; that is the population at the selected venue is expected to be in equilibrium. As we will compare the differences of SNPs between Schizophrenia patients and normal individuals, the consequences generated by Genepop can except the fluctuation between cultural or geographic populations. The standard mistake of this estimation is much less that 0.01, and the consequences from the appraisal are expected to be dependable. Consequences generated by Haploview Linkage disequilibrium describes a state of affairs in which some combinations of allelomorphs or familial markers occur more or less often in a population than would be expected from a random formation of haplotypes from allelomorphs based on their frequences. Fig3: Haploview show of Schizophrenia patients Fig 4: Haploview show of control group Discussion Sample size